Efeito do Meio Rico em Hidrogênio na Atividade de AhR por TCDD

A toxicidade de TCDD é induzida principalmente por meio do caminho de AhR-ROS.13-15 Examinamos se o efeito antioxidativo do H2 dependia da inibição da atividade de AhR. Depois de colocar as HUVECs durante 1 h em meio normal com ou sem o CH ou meio rico em hidrogênio, as células foram expostas ao TCDD. As células foram coletadas 1 h após a exposição ao TCDD (enquanto o meio rico em H2 ainda continha H2 substancial) e 24 h após a exposição ao TCDD (quando o H2 era indetectável no meio). A translocação nuclear em AhR, um marcador de ativação de AhR, foi avaliada usando análise de Western Blot e a avaliação de mRNA de CYP1A1 e CYP1B1 foi avaliada usando RT-PCR em tempo real. A presença de CH em média suprimiu o aumento da translocação nuclear AhR às 1 e 24 h após a exposição ao TCDD; isto é, a translocação permaneceu nos níveis de controle. Em contraste, a presença de H2 em meio não suprimiu a translocação nuclear AhR às 1 ou 24 h após a exposição ao TCDD (Figuras 3A, B). Conforme mostrado nas Figuras 3C e D, na presença de CH, as expressões do ARNm CYP1A1 e CYP1B1 foram para aqueles que estavam no controle durante a exposição ao TCDD. No entanto, a presença de H2 não inibiu a expressão aumentada destes mRNA durante a exposição ao TCDD. Assim, ao contrário de CH, os efeitos antioxidativos do H2 não parecem depender da inibição da ativação de AhR.

O Hidrogênio Molecular Alivia a Senescência
Celular em Células Endoteliais

Fumihiko Hara, MD; Junko Tatebe, BSc; Ippei Watanabe, MD, PhD;

Junichi Yamazaki, MD, PhD; Takanori Ikeda, MD, PhD; Toshisuke Morita, MD, PhD

O hidrogênio molecular (H2) não tem polaridade e não é altamente reativo e, portanto, acredita-se que não tem efeitos sobre os organismos. No entanto, em 2007, relatou-se que a inalação de gás hidrogênio aliviou a lesão de isquemia-reperfusão cerebral em ratos, seletivamente removendo radicais citotóxicos e radicais hidroxílicos (OH).1 Desde então, pesquisas adicionais examinaram a inalação de hidrogênio e o consumo de água rica em hidrogênio, um método simplificado de ingestão de H2. Um estudo que utilizou ratinhos de apolipoproteína E (ApoE) -/- descobriu que a ingestão de água rica em hidrogênio aliviou o estresse oxidativo e reduziu significativamente a formação de aterosclerose2, melhorando o metabolismo lipídico e reduzindo a inflamação na parede vascular.3 Além disso, um estudo clínico sobre a ingestão de água rica em hidrogênio constatou que diminuiu o estresse oxidativo e melhorou o metabolismo de lipídios e glicose em pacientes com síndrome metabólica, diabetes tipo 2 e tolerância à glicose prejudicada.4-6 Com base nestes resultados, o H2 é agora considerado como uma molécula sinalizadora gasosa com atividade fisiológica semelhante à do óxido nítrico (NO), monóxido de carbono (CO) e sulfato de hidrogênio (H2S) .7 Estudos em animais mostraram que as concentrações sanguíneas do pico de H2 administrado por via oral em aproximadamente 15 min. e retornam aos níveis iniciais 20-30 minutos após a administração. Em seres humanos que bebem água enriquecida com hidrogênio, as concentrações de H2 no ar expirado atingem um pico em aproximadamente 10 min e retornam aos níveis iniciais às 1 h após a administração.8 Esses resultados indicam que, embora o H2 esteja apenas presente no corpo, ele pode ter efeitos antioxidantes sustentados. No entanto, os mecanismos subjacentes exatos a estes efeitos não são claros.

2,3,7,8-Tetrachlorodibenzo-p-dioxina (TCDD) é uma família de dioxinas - poluentes orgânicos persistentes que estão amplamente presentes no ambiente - e tem a maior toxicidade biológica entre as dioxinas.9 A TCDD se acumula no corpo humano e está associada a carcinogenicidade, teratogenicidade, distúrbios hepáticos, distúrbios da função reprodutiva, imunotoxicidade e disfunção endócrina, entre outras doenças.10 Além disso, estudos recentes mostraram que as prevalências de doenças coronárias e hipertensas eram maiores em pessoas expostas a concentrações relativamente elevadas de dioxinas em um acidente ou no trabalho.11,12 Doenças atribuíveis a dioxinas, incluindo TCDD, podem estar associadas à ativação de macrófagos por meio da ativação do receptor de hidrocarboneto de arilo (AhR) e subsequente indução de inflamação em vasos sanguíneos ou com senescência celular prematura mediada pela produção de espécies reativas de oxigênio (ROS) .
 

O AhR é um fator de transcrição ativado por ligante para o qual as dioxinas atuam como ligantes. Em seu estado estacionário, AhR está localizado no citoplasma, mas migra para o núcleo quando se liga a um ligante, como TCDD, e forma um complexo com translocador nuclear AhR (Arnt) localizado no núcleo. O complexo AhR-Arnt se liga a um elemento de resposta xenobiótica do gene e induz enzimas metabolizadoras de drogas - incluindo o citocromo P450 (CYP) 1A1 - e a expressão de um grande número de genes, como aqueles para citocinas e transdutores de sinal.15,16 Relatamos anteriormente que, nas células endoteliais vasculares, a toxina urêmica, o sulfato de indoxilo (IS), desencadeia a translocação nuclear de AhR atuando como um ligante de AhR, o que leva à produção de ROS. O ROS aumentado diminui o dinucleótido intracelular de nicotinamida adenina (NAD+), prejudicando a ativação da sirtuína 1 (Sirt1) e, em última instância, facilitando a senescência celular.17-19

À luz dos achados anteriores, examinamos os efeitos do H2 na senescência das células endoteliais da veia umbilical humana (HUVEC) e na via AhR-ROS em relação à mudança dependente do tempo de concentração de H2 no meio e descobrimos que o H2 exerce efeitos contínuos apesar de sua presença transiente no médio.
 

Métodos

Reagentes

O meio 199, suplemento de crescimento de células endoteliais, TCDD, CH223191 (CH) e crisina foram adquiridos de Sigma-Aldrich (St Louis, MO, EUA). O soro bovino fetal (FBS) foi adquirido de Indústrias Biológicas (Kibbutz Beit Haemek, Israel).

 

Produção de meio rico em hidrogênio

Um tanque foi preenchido com gás hidrogênio a uma pressão de 0,4 MPa, e o meio rico em hidrogênio foi produzido por pulverização do meio com uma bomba de alta pressão a partir do tanque de hidrogênio a uma pressão de 0,8 MPa (TED KK, Toyama, Japão). O meio rico em hidrogênio saturado foi armazenado sob pressão atmosférica a 4°C em uma bolsa de alumínio sem volume morto e foi utilizado em 1 semana.

 

Medição do Conteúdo de Hidrogênio no Meio de Cultura de Células

Resumidamente, 50 μl de meio foram injetados num recipiente de vidro de 10 ml com uma tampa, e os níveis de H2 na fase gasosa (1 ml) foram determinados utilizando cromatografia gasosa com um detector semicondutor (TRI lyzerTM mBA-3000; Taiyo KK , Osaka, Japão).20

 

Cultura de Células

As HUVECs foram compradas da Lonza Walkersville Inc. (Walkersville, MD, EUA) e cultivadas em uma placa revestida de colágeno tipo I (Asahi Glass, Tóquio, Japão) com meio 199 suplementado com 10% de FBS, 10 mmol/L de glutamina, 100 μg/ml de heparina, de 20 μg/ml de fator de crescimento endotélico, 100 μg/ml de genta micina e 100 μg/ml de anfotericina B em 5% de CO2 a 37°C. As células foram utilizadas para experiências entre as passagens 4 e 7.

As HUVECs passadas 4 a 7 vezes foram cultivadas em frascos de cultura revestidos de colágeno tipo I com uma superfície de 25 cm2 (Asahi Glass, Tóquio, Japão). Quando as HUVECs chegaram à confluência, as células foram pré-tratadas durante 1 h em meio normal ou rico em hidrogênio e depois incubadas com TCDD (1 nmol/L) durante 1, 6, 24 ou 48 h. Para determinar o mecanismo subjacente responsável pelos efeitos do H2, as células foram pré-tratadas durante 1 h com CH (10 μmol/L) ou crisina (10 μmol/L) e depois incubadas com TCDD (1 nmol/L) durante 1, 24 ou 48 h. Após a incubação, foram coletados ARNs totais, DNA, proteínas totais e frações nucleares.

Medição da 8-hidroxideoxiguanosina celular

O DNA foi extraído de HUVECs usando um Kit de Extração de DNA TIS (Wako, Osaka, Japão). A concentração de 8-hidroxideoxiguanosina (8OHdG) em HUVECs foi medida usando um kit Elisa Check 8OHdG Altamente Sensível (Instituto Japonês para o Controle do Envelhecimento, Shizuoka, Japão) após a preparação com um Conjunto de Reagente de Preparação de Ensaio 8OHdG (Wako, Osaka, Japão). Os resultados são expressos em picogramas por micrograma de DNA, corrigidos pela quantidade de DNA em cada amostra.

 

Medição do mRNA

ISOGEN (Nippon Gene Co, Ltd, Toyama, Japão) foi utilizado para extrair ARN total.

As expressões de mRNA de CYP1A1 e CYP1B1 foram analisadas com reação em cadeia quantitativa em tempo real de transcrição reversa-polimerase reversa (RT-PCR) usando um sistema de detecção de PCR em tempo real iQ5 (Bio-Rad, CA, EUA) e um Kit de Um Passo iScript RT-PCR com SYBR Green (Bio-Rad). As sequências dos iniciadores senso ou antissenso utilizados para amplificação foram

CYP1A1: 5’ CTTGGACCTCTTTGGAGCTG-3’,

5’-CGAAGGAAGAGTGTCGGAAG-3’;

CYP1B1: 5’-CACCAAGGCTGAGACAGTGA-3’,

5’ GATGACGACTGGGCCTACAT 3’; e

RPL13A: 5’ AAGCCTACAAGAAAGTTTGCCTATC-3’,

5’-TGTTTCCGTAGCCTCATGAGC-3’.

O sinal fluorescente do SYBR Green foi detectado imediatamente após o passo de extensão e o ciclo de limiar (Ct) foi registrado. O valor Ct do RPL13A serviu como o controle interno para normalização.

 

Coleta de Proteínas

Proteínas Totais As HUVECs foram homogeneizadas em tampão de lise gelado (1% de Triton X-100, 50 mmol/L de HEPES, pH 7,4, 100 mmol/L de pirofosfato de sódio, 100 mmol/L de fluoreto de sódio, 10 mmol/L de EDTA, 10 mmol/L de vanadato de sódio, 1 mmol/L de fluoreto de fenilmetilsulfonilo, 1 μg/ml de aprotinina e 5 μg/ml de leupeptina). Após centrifugação a 15.000 rpm durante 30 min a 4°C, o sobrenadante foi coletado como a proteína total.
 

Frações Nucleares
As HUVECs foram suspensas em solução salina tamponada com fosfato e homogeneizadas por 10 ciclos usando um homogeneizador de vidro Dounce. Os homogeneizados foram então centrifugados a 12 000 g durante 30 min. O sedimento foi recolhido e ressuspenso em 200 μl de tampão A gelado (10 mmol/L de HEPES-KOH, pH 7,9, 1,5 mmol/L de MgCl2, 10 mmol/L de KCl, 0,5 mmol/L de ditiotreitol, 0,2 mmol/L de fenilo fluoreto de metilsulfonilo, aprotinina a 5 μg/ml e 2-μg/ml de leupeptina). Após a mistura ter sido incubada em gelo durante 10 min, adicionou-se 10 μl de IGEPAL 10% à mistura, que depois foi agitada completamente durante 30 s e centrifugada a 12 000 g durante 20 minutos a 4°C. O sobrenadante foi então coletado como proteína nuclear.

 

Análise Western Blot

A amostra de proteína (2 ou 10 μg) de cada fração foi transferida eletroforéticamente para membranas de poli (fluoreto de vinilideno) em SDS-PAGE a 7,5% ou 10% e depois detectada usando anticorpo anti-AhR (R&D Systems, MN, EUA), anticorpo fator 2 anti relationado a (Nrf2) relacionado ao anti-fosfo-NF-E2 (Epitomics, Inc, CA, EUA), anticorpo anti-total Nrf2 (Cell Signaling Technology, Beverly, MA, EUA), anticorpo anti-heme oxigenase-1 (HO-1) (Stressgen Biotechnologies Inc, CA, EUA), anticorpo anti-NAD(P)H:quinone oxidoreductase-1 (NQO-1) (R&D Systems), anticorpo p53 anti-total (Merck Millipore), anticorpo anti-laminação A/C (Cell Signaling Technology) ou anticorpo de β-actina (Santa Cruz Biotechnology, CA, EUA). As imagens foram adquiridas em um sistema ChemiDoc XRS (Bio-Rad) e analisadas com o software PDQuest (Bio-Rad). Os dados sobre as expressões de proteínas específicas foram sempre normalizados para a β-actina, e a expressão nuclear de AhR foi particularmente normalizada para laminação A/C. Os resultados são expressos como coeficiente de aumento em relação ao controle.

 

Medição de NAD+ Celular

O NAD celular foi medido usando um Kit de Quantificação de NAD+/NADH (BioVision, Inc, Milpitas, CA, EUA) de acordo com as instruções do fabricante. Este kit usa uma reação enzimática para detectar especificamente NAD+ e NADH, e é um método conveniente para medição sensível de NAD+, NADH e sua proporção.

 

Ensaio de Atividade Sirt1

As HUVECs foram homogeneizadas num tampão de lise gelado (50 mmol/L de Tris-HCl, pH 7,4, 150 mmol/L de NaCl, 1 mmol/L de fluoreto de fenilmetilsulfonilo, 5 µg/ml de leupeptina e 1 µg/ml de aprotinina) e  proteína total no sobrenadante foi obtida após centrifugação a 15.000 rpm durante 10 min a 4°C. A atividade de Sirt1 na proteína total foi determinada usando um kit de análise colorimétrica de histona deacetilase (Enzo Life Sciences Inc, NY, EUA) de acordo com as instruções do fabricante.

 

Coloração da p-galactosidase Associada à Senescência

Para avaliar as alterações senescentes no fenótipo das HUVECs, utilizamos um kit de coloração de β-galactosidase (SA-gal) associado à senescência (BioVision, Inc) para colorir SA β-gal, um biomarcador bem estabelecido de senescência celular. A porcentagem de células SA β-gal positivas foi determinada usando um microscópio (×100) para contar o número de células azuis e células totais em 2 campos diferentes por amostra. Os números das células foram medidos utilizando software de análise de imagem (WinROOF; Mitani Corporation, Japão).
 

Analise estatística

Os resultados são expressos como média ± erro padrão da média. As comparações entre grupos foram realizadas usando ANOVA unidirecional. Um valor de P <0,05 foi considerado para indicar significância estatística.

Métodos

Mudança na Concentração de H2

A concentração de H2 foi de 0,55±0,07 mmol/L em meio rico em hidrogênio fresco. As HUVECs foram cultivadas neste meio rico em hidrogênio com ou sem exposição ao TCDD, e a mudança temporal na concentração de H2 foi investigada. Uma concentração de TCDD de 1nmol/L foi selecionada, de acordo com relatórios anteriores.21 Conforme mostrado na Figura 1, a concentração de H2 não diferiu significativamente entre a mídia com e sem TCDD. 16 h após a exposição ao TCDD, a concentração atmosférica de H2 era normal.

Efeito do Meio Rico em Hidrogênio em Produtos Oxidativos Celulares

Utilizamos um ELISA para avaliar o 8OHdG intracelular, um marcador de estresse oxidativo para o ácido nucleico. As HUVECs foram pré-tratadas durante 1 h em meio normal na presença ou ausência de CH10 inibidor de AhR ou meio rico em hidrogênio e depois incubadas com TCDD por 1, 24 ou 48 h. O teor de 8OHdG de HUVECs foi então ensaiado. O conteúdo de 8OHdG não diferiu entre HUVECs cultivadas durante 48 h na presença ou ausência de H2; no entanto, em comparação com os valores de controle, 8OHdG foi significativamente maior de 1 a 48 h após a exposição ao TCDD. H2 suprimiu significativamente o aumento induzido por TCDD no 8OHdG intracelular até 24 h, depois que o H2 se tornou indetectável no meio. Às 48 h, o 8OHdG intracelular aumentou para um nível semelhante ao observado durante a exposição ao TCDD sem H2, o que indica que o efeito antioxidativo do H2 havia cessado. O CH suprimiu significativamente o aumento de 8OHdG intracelular até 48 h normal.

Histórico: Evidências substanciais indicam que o hidrogênio molecular (H2) tem efeitos vasculares benéficos por causa de seus efeitos antioxidantes e/ou anti-inflamatórios. Assim, a água rica em hidrogênio pode revelar-se uma bebida antienvelhecimento eficaz. Este estudo examinou os efeitos do H2 sobre a senescência endotelial e esclareceu os mecanismos envolvidos.

Métodos e Resultados: O meio rico em hidrogênio foi produzido por um gerador de gás hidrogênio de alta pureza. As células endoteliais da veia umbilical humana (HUVECs) foram incubadas com 2,3,7,8-tetraclorodibenzo-p-dioxina (TCDD) por vários períodos de tempo em meio normal ou rico em hidrogênio. A concentração inicial de H2 em meio rico em hidrogênio foi de 0,55±0,07 mmol/L. Esta concentração diminuiu gradualmente, e o H2 era quase indetectável em meio após 12 h. Às 24 h após a exposição ao TCDD, as HUVEC tratadas com TCDD apresentaram aumento da expressão de 8OHdG e de acetilação da p53, redução da proporção de dinucleótido de nicotinamida adenina (NAD+)/NADH, atividade de Sirt1 prejudicada e β-galactosidase associada à senescência aumentada. No entanto, as HUVEC incubadas em meio rico em hidrogênio não apresentaram essas alterações induzidas por TCDD que acompanham a ativação de Nrf2, o que foi observado mesmo após o H2 ser indetectável no meio. Crisina, um inibidor de Nrf2, aboliu os efeitos protetores do H2 nas HUVECs.

Conclusões: O H2 tem efeitos duradouros antioxidantes e antienvelhecimento nas células endoteliais vasculares através da via Nrf2, mesmo após a exposição transitória ao H2. A água rica em hidrogênio pode, portanto, ser uma bebida funcional que aumenta a longevidade. (J Circ 2016; 80: 2037 – 2046)

Palavras-Chave: Antioxidante; Senescência endotelial; Hidrogênio molecular; Nrf2

Efeito do Meio Rico em Hidrogênio na Ativação de Nrf2

O fator de transcrição, Nrf2, controla a expressão de enzimas desintoxicantes e antioxidantes, contribuindo assim para a capacidade do organismo de manter a homeostase durante o estresse.22 Portanto, investigamos se os efeitos antioxidantes do H2 podem depender da ativação de Nrf2, usando análise de Western Blot, Sis para avaliar a expressão de fosfo-Nrf2 e suas enzimas antioxidantes, HO-1 e NQO-1, após exposição de HUVECs ao TCDD. No meio enriquecido com H2, a expressão de fosfo-Nrf2 foi aumentada 1 h após a exposição ao TCDD (isto é, quando H2 era abundante) (dados não mostrados). A expressão permaneceu elevada 24 h após a exposição ao TCDD, quando o H2 retornou aos níveis iniciais. Houve também aumentos significativos nas expressões HO-1 e NQO-1 (Figuras 4A, C). No entanto, 48 h após a exposição ao TCDD, tanto a fosforilação de Nrf2 como a expressão de HO-1/NQO-1 retornaram aos níveis iniciais (Figuras 4B, D). Esses resultados sugerem que os efeitos antioxidantes sustentados do H2 estão relacionados à ativação de Nrf2 e seu grupo enzimático antioxidante associado.

Efeitos do Meio Rico em Hidrogênio na Acetilação de p53

A ativação de p53 por acetilação foi relatada como associada à senescência celular causada pelo estresse oxidativo.23 Utilizamos a análise Western Blot para avaliar a expressão de acetilação da p53  24 e 48 h após a exposição ao TCDD, para avaliar o possível papel do H2 na supressão da senescência celular . A expressão total de p53 nas HUVECs não diferiu significativamente entre meios normais e ricos em hidrogênio ou entre meios com e sem TCDD (Figuras 5A, B). Embora a expressão de acetilação da p53 tenha sido significativamente maior 24 h após a exposição ao TCDD do que no controle, o H2 suprimiu significativamente esse aumento na expressão de acetilação da p53 (Figura 5A). No entanto, como mostrado na Figura 5B, 48 h após a exposição ao TCDD, o H2 não suprimiu o aumento induzido por TCDD na expressão de acetil-53.

Efeitos do Meio Rico em Hidrogênio na Razão NAD+/NADH e Atividade de Sirt1

Nós relatamos anteriormente que, nas células endoteliais vasculares, o estresse oxidativo induzido pela ativação de AhR diminui o NAD+ intercelular, o que reduz a atividade da deacetilase Sirt1 dependente de NAD e promove a senescência celular.18,19 No presente estudo, avaliamos a relação NAD+/NADH E Sirt1 por ensaio colorimétrico. Conforme mostrado na Figura 6A, às 48 h, a relação NAD+/NADH não diferiu significativamente entre HUVECs cultivadas na presença e ausência de H2. No entanto, a relação NAD+/NADH foi significativamente menor 6 a 48 h após a exposição ao TCDD, em comparação com o controle. Por outro lado, nas HUVEC cultivadas em H2 e expostas ao TCDD, a relação NAD+/NADH foi equivalente à do controle até 24 h; isto é, depois que o H2 desapareceu do meio. Não houve diferença significativa na atividade de Sirt1 entre células cultivadas na presença e ausência de H2 por 48 h, como foi o caso da relação NAD+/NADH. No entanto, a exposição à TCDD reduziu significativamente a atividade Sirt1 de 6 para 48 h, em comparação com o controle. Por outro lado, a atividade Sirt1 no grupo H2+ TCDD permaneceu semelhante à do controle de 6 a 24 h, após o H2 ser indetectável no meio, como foi o caso da relação NAD+/NADH (Figura 6B). Este efeito cessou às 48 h após a exposição ao TCDD.

Efeitos do Meio Rico em Hidrogênio na Senescência Celular

Utilizamos a coloração SA β-gal para determinar o número de células senescentes 24 e 48 h após a exposição das HUVEC a TCDD. O número de células SA β-gal positivas foi significativamente maior às 24 h após a exposição ao TCDD (18,6 ± 3,8% vs. 5,5 ± 1,4% das células SA β-gal positivas no controle). Em contraste, em meio com H2 e TCDD, a porcentagem de células SA β-gal positivas foi semelhante à do controle, 5,5 ± 1,9% (Figura 7A). 48 horas após a exposição ao TCDD, a porcentagem de células SA β-gal positivas foi significativamente maior do que no controle (19,7 ± 3,6% vs. 5,2 ± 1,3%) e a porcentagem de células SA β-gal positivas foi de 16,4±3,2% em células expostas a TCDD cultivadas em meio rico em hidrogênio, o que indica que, às 48 h, H2 não suprimiu mais o aumento de células SA β-gal positivas (Figura 7B)

 

Efeitos da Crisina nas Alterações Induzidas por H2 nas HUVECs

Realizamos experimentos usando um inibidor farmacológico de Nrf-2 (crisina) para determinar se os efeitos antioxidantes e anti-senescência do hidrogênio eram dependentes da ativação de Nrf2. Uma concentração de 10 μmol/L de crisina foi selecionada, de acordo com um relatório anterior.24 Conforme mostrado na( Figura 8,) o tratamento com crisina aboliu os efeitos antioxidantes e anti-senescência do hidrogênio nas HUVECs 24 h após a exposição ao TCDD.

Discussão

Nossos resultados indicam que, mesmo após a concentração de H2 no meio ter diminuído para à do meio de controle, o estresse oxidativo e a senescência celular causada pela ativação da via TCDD-AhR continuaram sendo inibidos nas HUVECs. Esses achados sugerem que os efeitos prolongados de antioxidação e anti-senescência causados pela exposição transitória ao hidrogênio dependem da ativação sustentada de Nrf2 e HO-1/NQO-1 em HUVECs.

Como é o caso de outros gases bioativos endógenos, como NO, CO e H2S, o H2 tem efeitos benéficos em uma variedade de doenças.25,26 Vários estudos em animais descobriram que a administração de água rica em hidrogênio reduz o estresse oxidativo, protege a função cognitiva e suprime a aterosclerose.2,3 Em estudos em seres humanos, a ingestão oral de água rica em hidrogênio 3-5 vezes por dia diminuiu o estresse oxidativo em pacientes com doenças crônicas como diabetes tipo 2, síndrome metabólica e doença de Parkinson e melhorou a qualidade de vida.4-6,27 Esses resultados sugerem que a água enriquecida em H2 tem benefícios para esses pacientes. Em animais, as concentrações sanguíneas de H2 administrado oralmente atingem um pico de 5 a 15 min. e retornam ao nível inicial 30 minutos após a administração. Em seres humanos que ingeriram água rica em H2 por via oral, a concentração de H2 no ar expirado atingiu um pico em aproximadamente 10 min e voltou ao nível inicial 1 h após a ingestão.8,28,29 Em suma, resultados anteriores e atuais indicam que, embora o aumento no H2 no corpo seja transiente, seus efeitos antioxidantes são mantidos mesmo quando o H2 suplementar não é mais detectável. No entanto, os mecanismos responsáveis por este efeito contínuo não ficaram claros. Avaliamos os efeitos do H2 dissolvido em culturas celulares com meio rico em hidrogênio. A concentração de H2 diminuiu para 2,5% do seu pico às 12 h e foi indetectável às 16 h, o que indica que o H2 degrada rapidamente em meio rico em hidrogênio.

evidências existentes indicam que a exposição ao TCDD está associada ao desenvolvimento de doenças coronárias e hipertensivas, por meio da ativação de AhR 11,12. Doenças atribuíveis a dioxinas, incluindo TCDD, podem resultar da ativação de macrófagos por meio da ativação de AhR e posterior indução de inflamação dos vasos sanguíneos ou senescência celular prematura mediada pela produção de ROS.13,14 Curiosamente, a exposição ao TCDD está fortemente associada à senescência celular. Nós demonstraram anteriormente que a produção de ROS por meio da ativação de AhR por IS reduziu o NAD+ celular e suprimiu a atividade de Sirt1, acelerando assim a senescência celular.18,19 Quando examinamos pela primeira vez se o H2 suprime o estresse oxidativo por meio da via TCDD-AhR, descobrimos que, em meio rico em hidrogênio, o aumento induzido por TCDD em 8OHdG em HUVECs foi significativamente suprimido e que esses efeitos eram semelhantes aos do inibidor de AhR, CH. Procuramos então determinar se os efeitos antioxidantes do H2 nas HUVECs dependiam da inibição de AhR. No entanto, mesmo quando as concentrações de H2 no meio eram mais altas, não houve inibição de AhR. Assim, os efeitos antioxidantes do H2 não dependem da inibição da atividade de AhR.

O fator de transcrição, Nrf2, desencadeia genes antioxidantes como HO-1 e NQO-1 em resposta ao estresse oxidativo e, portanto, tem um papel muito importante como fator regulatório na prevenção do estresse oxidativo.22 Os efeitos antioxidativos do H2 Parecem ser parcialmente atribuíveis à indução de Nrf2.30 Em um estudo anterior, relatamos que o HO-1 suprime o dano celular resultante do estresse oxidativo, o que é importante na progressão da aterosclerose.31 Examinamos, portanto, a relação entre a atividade antioxidante do H2 e a ativação de Nrf2/HO-1 e observamos uma maior expressão de fosfo-Nrf2 e suas enzimas antioxidantes relacionadas, HO-1 e NQO-1, quando a concentração de H2 era máxima e às 24 h, quando o H2 era indetectável no meio. Às 48 h, o aumento da expressão de fosfo-Nrf2 e seu grupo enzimático antioxidante associado diminuiu. Além disso, a inibição farmacológica aboliu a expressão de HO-1 e NQO-1 induzida por hidrogénio. Em conjunto, esses resultados sugerem que os efeitos antioxidantes contínuos do H2 são, pelo menos, parcialmente atribuíveis à indução do grupo enzimático antioxidante associado à ativação de Nrf2.

A senescência celular induzida pelo estresse oxidativo aumentado é importante na aterosclerose acelerada.32,33 Além disso, a ativação de p53 por acetilação foi associada à senescência celular causada pelo estresse oxidativo.23 Para examinar ainda mais os efeitos do H2 na prevenção da senescência celular, avaliamos a indução de acetilação da p53 em HUVECs tratadas com água rica em hidrogênio. O H2 diminuiu significativamente a indução de acetilação da p53 às 24 h após a incubação de TCDD.

Sirt1, o homólogo mais próximo do regulador de informação silencioso (Sir2), é uma histona desacetilase dependente de NAD+. Este gene de longa duração está associado à apoptose celular e à resposta ao estresse implicada no mecanismo da senescência celular.34 Relatamos anteriormente que uma diminuição no NAD+ celular causada pela produção de ROS suprimiu a atividade Sirt1, o que resultou em uma senescência celular acelerada.17-19 Outros estudos relataram que o estresse oxidativo e a senescência celular foram melhorados nas células endoteliais que sobre-expuseram Sirt1.35 No presente estudo, examinamos se a ativação de NAD+-Sirt1 influenciou a diminuição induzida por H2 na expressão de acetilação da p53 em HUVECs incubadas com TCDD . Descobrimos que a relação NAD+/NADH e a atividade Sirt1 em HUVEC tratadas com TCDD incubadas com H2 foram comparáveis às das HUVEC de controle até 24 h; isto é, após o H2 ser indetectável no meio, um período durante o qual a porcentagem de células SA β-gal positivas diminuiu. No entanto, às 48 h após a exposição de TCDD, nenhuma dessas alterações induzidas pelo hidrogênio foi observada. Além disso, a crisina bloqueou os efeitos anti-senescentes do hidrogênio nas HUVEC tratadas com TCDD. Esses resultados sugerem que os efeitos anti-senescentes do hidrogênio são mediados pela ativação sustentada de Nrf2 e seu grupo enzimático antioxidante associado.

Conclusões

O H2 claramente suprimiu o estresse oxidativo e a senescência celular em HUVECs por meio da ativação sustentada de Nrf2, mesmo após as concentrações de H2 serem indetectáveis. A ingestão regular de água rica em hidrogênio pode, assim, produzir efeitos de H2 contínuos em seres humanos.

Reconhecimentos

Agradecemos a TED Co, Ltd e a Amuru Technica Co, Ltd pela ajuda com a preparação de meio rico em hidrogênio.

Conflitos de Interesse

Nenhum.

Referências

1. Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K, et al. Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals. Nat Med 2007; 13: 688 – 694.

2. Ohsawa I, Nishimaki K, Yamagata K, Ishikawa M, Ohta S. Consumption of hydrogen water prevents atherosclerosis in apolipoprotein E knockout mice. Biochem Biophys Res Commun 2008; 377: 1195 – 1198.

3. Song G, Tian H, Qin S, Sun X, Yao S, Zong C, et al. Hydrogen decreases athero-susceptibility in apolipoprotein B-containing lipoproteins and aorta of apolipoprotein E knockout mice. Atherosclerosis 2012; 221: 55 – 65.

4. Nakao A, Toyoda Y, Sharma P, Evans M, Guthrie N. Effectiveness of hydrogen rich water on antioxidant status of subjects with potential metabolic syndrome: An open label pilot study. J Clin Biochem Nutr 2010; 46: 140 – 149.

5. Song G, Li M, Sang H, Zhang L, Li X, Yao S, et al. Hydrogen-rich water decreases serum LDL-cholesterol levels and improves HDL function in patients with potential metabolic syndrome. J Lipid Res 2013; 54: 1884 – 1893.

6. Kajiyama S, Hasegawa G, Asano M, Hosoda H, Fukui M, Nakamura N, et al. Supplementation of hydrogen-rich water improves lipid and glucose metabolism in patients with type 2 diabetes or impaired glucose tolerance. Nutr Res 2008; 28: 137 – 143.

7. Kajimura M, Nakanishi T, Takenouchi T, Morikawa T, Hishiki T, Yukutake Y, et al. Gas biology: Tiny molecules controlling metabolic systems. Respir Physiol Neurobiol 2012; 184: 139 – 148.

8. Shimouchi A, Nose K, Shirai M, Kondo T. Estimation of molecular hydrogen consumption in the human whole body after the ingestion of hydrogen-rich water. Adv Exp Med Biol 2012; 737: 245 – 250.

9. Nhu DD, Kido T, Naganuma R, Sawano N, Tawara K, Nishijo M, et al. A GIS study of dioxin contamination in a Vietnamese region sprayed with herbicide. Environ Health Prev Med 2009; 14: 353 –360.

10. Mukerjee D. Health impact of polychlorinated dibenzo-p-dioxins: A critical review. J Air Waste Manag Assoc 1998; 48: 157 – 165.

11. Bertazzi PA, Bernucci I, Brambilla G, Consonni D, Pesatori AC. TheSeveso studies on early and long-term effects of dioxin exposure: A review. Environ Health Perspect 1998; 106(Suppl 2): 625 – 633.

12. Pelclová D, Fenclová Z, Preiss J, Procházka B, Spácil J, Dubská Z, et al. Lipid metabolism and neuropsychological follow-up study of workers exposed to 2,3,7,8-tetrachlordibenzo-p-dioxin. Int Arch Occup Environ Health 2002; 75(Suppl): S60 – S66.

13. Wu D, Nishimura N, Kuo V, Fiehn O, Shahbaz S, Van Winkle L, et al. Activation of aryl hydrocarbon receptor induces vascular inflammation and promotes atherosclerosis in apolipoprotein E–/– mice. Arterioscler Thromb Vasc Biol 2011; 31: 1260 – 1267.

14. Nie X, Liang L, Xi H, Jiang S, Jiang J, Tang C, et al. 2,3,7,8-Tetrachlorodibenzo-p-dioxin induces premature senescence of astrocytes via WNT/β-catenin signaling and ROS production. J Appl Toxicol 2015; 35: 851 – 860.

15. Mimura J, Fujii-Kuriyama Y. Functional role of AhR in the expression of toxic effects by TCDD. Biochim Biophys Acta 2003; 1619:263 – 268.

16. Kawajiri K, Fujii-Kuriyama Y. Cytochrome P450 gene regulation and physiological functions mediated by the aryl hydrocarbon receptor. Arch Biochem Biophys 2007; 464: 207 – 212.

17. Masai N, Tatebe J, Yoshino G, Morita T. Indoxyl sulfate stimulates monocyte chemoattractant protein-1 expression in human umbilical vein endothelial cells by inducing oxidative stress through activation of the NADPH oxidase-nuclear factor-κB pathway. Circ J 2010; 74: 2216 – 2224.

18. Watanabe I, Tatebe J, Namba S, Koizumi M, Yamazaki J, Morita T. Activation of aryl hydrocarbon receptor mediates indoxyl sulfateinduced monocyte chemoattractant protein-1 expression in human umbilical vein endothelial cells. Circ J 2013; 77: 224 – 230.

19. Koizumi M, Tatebe J, Watanabe I, Yamazaki J, Ikeda T, Morita T. Aryl hydrocarbon receptor mediates indoxyl sulfate-induced cellular senescence in human umbilical vein endothelial cells. J Atheroscler Thromb 2014; 21: 904 – 916.

20. Terawaki H, Zhu WJ, Matsuyama Y, Terada T, Takahashi Y, Sakurai K, et al. Effect of a hydrogen (H2)-enriched solution on the albumin redox of hemodialysis patients. Hemodial Int 2014; 18:459 – 466.

21. Kopf PG, Walker MK. 2,3,7,8-Tetrachlorodibenzo-p-dioxin increases reactive oxygen species production in human endothelial cells via induction of cytochrome P4501A1. Toxicol Appl Pharmacol 2010; 245: 91 – 99.

22. Surh YJ, Kundu JK, Na HK. Nrf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals. Planta Med 2008; 74: 1526 – 1539.

23. Zhuge CC, Xu JY, Zhang J, Li W, Li P, Li Z, et al. Fullerenol protects retinal pigment epithelial cells from oxidative stress-induced premature senescence via activating SIRT1. Invest Ophthalmol Vis Sci 2014; 55: 4628 – 4638.

24. Gao AM, Ke ZP, Shi F, Sun GC, Chen H. Chrysin enhances sensitivity of BEL-7402/ADM cells to doxorubicin by suppressing PI3K/ Akt/Nrf2 and ERK/Nrf2 pathway. Chem Biol Interact 2013; 206: 100 – 108.

25. Itoh T, Fujita Y, Ito M, Masuda A, Ohno K, Ichihara M, et al. Molecular hydrogen suppresses FcepsilonRI-mediated signal transduction and prevents degranulation of mast cells. Biochem Biophys Res Commun 2009; 389: 651 – 656.

26. Barr LA, Calvert JW. Discoveries of hydrogen sulfide as a novel cardiovascular therapeutic. Circ J 2014; 78: 2111 – 2118. 27. Yoritaka A, Takanashi M, Hirayama M, Nakahara T, Ohta S, Hattori N. Pilot study of H2 therapy in Parkinson’s disease: A randomized double-blind placebo-controlled trial. Mov Disord 2013; 28: 836 – 839.

28. Cardinal JS, Zhan J, Wang Y, Sugimoto R, Tsung A, McCurry KR, et al. Oral hydrogen water prevents chronic allograft nephropathy in rats. Kidney Int 2010; 77: 101 – 109.

29. Sobue S, Yamai K, Ito M, Ohno K, Ito M, Iwamoto T, et al. Simul taneous oral and inhalational intake of molecular hydrogen additively suppresses signaling pathways in rodents. Mol Cell Biochem 2015; 403: 231 – 241.

30. Song G, Zong C, Zhang Z, Yu Y, Yao S, Jiao P, et al. Molecular hydrogen stabilizes atherosclerotic plaque in low-density lipoprotein receptor-knockout mice. Free Radic Biol Med 2015; 87: 58 – 68.

31. Morita T, Imai T, Sugiyama T, Katayama S, Yoshino G. Heme oxygenase-1 in vascular smooth muscle cells counteracts cardiovascular damage induced by angiotensin II. Curr Neurovasc Res 2005; 2: 113 – 120.

32. Matthews C, Gorenne I, Scott S, Figg N, Kirkpatrick P, Ritchie A, et al. Vascular smooth muscle cells undergo telomere-based senescence in human atherosclerosis: Effects of telomerase and oxidative stress. Circ Res 2006; 99: 156 – 164.

33. de Zeeuw P, Wong BW, Carmeliet P. Metabolic adaptations in diabetic endothelial cells. Circ J 2015; 79: 934 – 941.

34. Imai S, Guarente L. NAD+ and sirtuins in aging and disease. Trends Cell Biol 2014; 24: 464 – 471.

35. Ota H, Akishita M, Eto M, Iijima K, Kaneki M, Ouchi Y. Sirt1 modulates premature senescence-like phenotype in human endothelial cells. J Mol Cell Cardiol 2007; 43: 571 – 579.